Elsevier

Virology

Volume 65, Issue 1, May 1975, Pages 128-134
Virology

Clonal cell lines from a feral mouse embryo which lack host-range restrictions for murine leukemia viruses

https://doi.org/10.1016/0042-6822(75)90013-6Get rights and content

Abstract

Tissue culture cell lines highly sensitive to both N- and B-tropic host-range variants of mouse-tropic murine leukemia virus (MuLV) were derived by clonal selection from a feral mouse embryo cell culture line. The clonal lines are more sensitive than standard assay cultures, particularly for isolating naturally occurring N- and B-tropic MuLV from tissue extracts. Also, they can support the replication of xenotropic MuLV to a limited extent.

The host-range patterns of N- and B-tropic viruses are not altered by serial passage in the sensitive cells.

It is presumed that these cell lines lack the Fv-1 gene function, and it is suggested that Fv-1 may have a much broader inhibitory effect than previously recognized.

References (10)

  • W.P. Rowe et al.

    Plaque assays for murine leukemia viruses

    Virology

    (1970)
  • M.B. Gardner et al.

    Unusually high incidence of spontaneous lymphomas in wild house mice

    J. Nat. Cancer Inst.

    (1973)
  • S. Gisselbrecht et al.

    Dual susceptibility of a 3T3 mouse cell line to infection by N- and B-tropic murine leukemia virus: Apparent lack of expression of the Fv-1 gene

    Int. J. Cancer

    (1974)
  • J.W. Hartley et al.

    Host-range restrictions of murine leukemia viruses in mouse embryo cell cultures

    J. Virol.

    (1970)
  • M.M. Lieber et al.

    S-tropic murine type-C viruses: Frequency of isolation from continuous cell lines, leukemia virus preparations, and normal spleens

    Int. J. Cancer

    (1974)
There are more references available in the full text version of this article.

Cited by (260)

  • Second site mutation in the virus envelope expands the host range of a cytopathic variant of Moloney murine leukemia virus

    2012, Virology
    Citation Excerpt :

    E114G was introduced by overlap PCR using forward primer 5′–CCAGACAACTCATAAATCAAATGGAGGATTTTATGTTTGCCCCGG and its reverse complement. Virus titers were determined by the XC overlay test after infecting cultures of NIH 3T3, SC-1 (Hartley and Rowe, 1975), M. dunni (Hartley and Rowe, 1975), Rat2 cells (CRL-1764), and Chinese hamster E36 cells (Gillin et al., 1972) or Lec8 cells (CRL-1737). Cells were plated at 1–2×105 cells/60 mm dish and infected with 0.2 ml of appropriate dilutions of virus stocks in the presence of polybrene (4 ug/ml; Aldrich, Milwaukee, WI).

  • Retroelements in the Mouse

    2007, The Mouse in Biomedical Research
  • Retroelements in the Mouse

    2006, The Mouse in Biomedical Research: History, Wild Mice, and Genetics: Volume 1-4, Second Edition
View all citing articles on Scopus
View full text