Clonal cell lines from a feral mouse embryo which lack host-range restrictions for murine leukemia viruses
References (10)
- et al.
Plaque assays for murine leukemia viruses
Virology
(1970) - et al.
Unusually high incidence of spontaneous lymphomas in wild house mice
J. Nat. Cancer Inst.
(1973) - et al.
Dual susceptibility of a 3T3 mouse cell line to infection by N- and B-tropic murine leukemia virus: Apparent lack of expression of the Fv-1 gene
Int. J. Cancer
(1974) - et al.
Host-range restrictions of murine leukemia viruses in mouse embryo cell cultures
J. Virol.
(1970) - et al.
S-tropic murine type-C viruses: Frequency of isolation from continuous cell lines, leukemia virus preparations, and normal spleens
Int. J. Cancer
(1974)
There are more references available in the full text version of this article.
Cited by (260)
Second site mutation in the virus envelope expands the host range of a cytopathic variant of Moloney murine leukemia virus
2012, VirologyCitation Excerpt :E114G was introduced by overlap PCR using forward primer 5′–CCAGACAACTCATAAATCAAATGGAGGATTTTATGTTTGCCCCGG and its reverse complement. Virus titers were determined by the XC overlay test after infecting cultures of NIH 3T3, SC-1 (Hartley and Rowe, 1975), M. dunni (Hartley and Rowe, 1975), Rat2 cells (CRL-1764), and Chinese hamster E36 cells (Gillin et al., 1972) or Lec8 cells (CRL-1737). Cells were plated at 1–2×105 cells/60 mm dish and infected with 0.2 ml of appropriate dilutions of virus stocks in the presence of polybrene (4 ug/ml; Aldrich, Milwaukee, WI).
Retroelements in the Mouse
2007, The Mouse in Biomedical ResearchRetroelements in the Mouse
2006, The Mouse in Biomedical Research: History, Wild Mice, and Genetics: Volume 1-4, Second EditionRestriction factors: A defense against retroviral infection
2003, Trends in Microbiology
Copyright © 1975 Published by Elsevier Inc.