Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression
Human gene for the RNA polymerase II seventh subunit (hsRPB7): structure, expression and chromosomal localization
Introduction
RNA polymerase II (Pol II) is the enzymatic complex responsible for transcription of genes that result in messenger RNA (mRNA) production. RNA polymerase II is composed of 10–14 subunits ranging in size from 220 to 10 kDa [1]. This complex interacts with the promoter regions of genes as well as with a variety of elements and transcription factors to determine essentially all of the parameters that govern transcription (e.g., tissue and developmental specificity, stress response, etc., see review [2]). Presently, human cDNAs have been isolated and chromosomal localization performed on a total of seven of the Pol II complex genes 3, 4, 5. However, to date, the complete genomic sequence has been reported for only the 220 kDa [4]and 14.5 kDa [5]subunits.
During the process of screening a macula-enriched subtraction library [6], we isolated a cDNA clone that was determined, during a BLAST [7]database search, to be hsRPB7 [8]. Although hsRPB7 message expression is only two-fold enriched between macula and peripheral retina, its chromosomal localization to 11q13.1 made this gene a possible candidate for several genetic diseases located in this area. Due to the overall importance of the Pol II complex and the possible involvement of this gene in genetic disease, we have characterized and localized the human gene for hsRPB7 as well as determined its relative level of expression in a variety of human tissues.
Section snippets
5′ Rapid amplification of cDNA ends (5′ RACE)
The 5′ RACE was performed using a previously published technique [9]. Two hsRPB7 specific primers were used: 5253 (5′TGTGCCACTTCGTCTTCGAGA3′) and 5440 (5′TACAGAACGAAGTAGAGAGCTG3′).
Screening of a human genomic library
A human genomic library constructed in PWE-15 (Clontech, Palo Alto, CA) was screened using a 32P-labelled PCR product from the hsRPB7 cDNA. The PCR product was labeled with [32P]dCTP to a specific activity of approximately 5×109 cpm/μg using a PCR-labeling technique [10]. Approximately 300 000 clones were screened
Isolation of hsRPB7 cDNA and 5′ RACE
The hsRPB7 cDNA was isolated during a solid-phase subtraction between the macula and peripheral areas of the retina as previously described [6]. Northern blot analysis of total RNA from monkey macula and peripheral retina demonstrates that hsRPB7 is enriched about 2-fold in the macula versus peripheral retina (Fig. 1). The original isolate was identified by performing a GenBank search using the National Center for Biological Information BLAST server program [7]. The search identified this clone
Discussion
Our interest in cloning the hsRPB7 gene was 3-fold: its chromosomal localization, its high and differential expression in the macula region of the retina and its fundamental importance in RNA transcription. Based on our radiation hybrid and YAC analysis, the hsRPB7 gene is located in chromosome 11 band q13.1, closely associated with the marker D11S1765. Attempts to associate this gene with other markers in the area using our YACs and PAC have been unsuccessful so far. However, we have localized
References (23)
Cell
(1994)- et al.
Genomics
(1994) - et al.
Gene
(1995) - et al.
Biochem. Biophys. Res. Commun.
(1995) - et al.
J. Mol. Biol.
(1990) - et al.
J. Biol. Chem.
(1994) - et al.
Genomics
(1992) - et al.
Genomics
(1994) Toxicol. Lett.
(1993)- et al.
Cell
(1995)