Research reportIdentification and characterization of RPTPρ, a novel RPTPμ/κ-like receptor protein tyrosine phosphatase whose expression is restricted to the central nervous system
Introduction
Protein tyrosine phosphorylation is a reversible, dynamic process which has been linked to the regulation of diverse cellular functions including signal transduction, growth, differentiation, axon guidance and cell–cell contact [35]. These cellular processes are, to a large extent, controlled by a balance between the actions of protein tyrosine kinases (PTKs) and protein tyrosine phosphatases (PTPs) 7, 34, 35, 47, 60, 61. Protein tyrosine phosphatases are categorized as either transmembrane receptor-like, or intracellular, molecules. The overall structure of receptor-like PTPs (RPTPs) is similar to that of receptor-like PTKs; both contain an extracellular region, a single transmembrane segment, and an intracellular catalytic domain. In the majority of RPTPs, the catalytic region contains two highly conserved phosphatase domains of approximately 230 AA residues. The structural features of transmembrane RPTPs suggest the potential to bind ligands and convert extracellular signals into intracellular responses.
Receptor protein tyrosine phosphatases have been subdivided into several classes based on the structure of their extracellular segments 19, 60. The extracellular segment of type II RPTPs contains a combination of immunoglobulin (Ig)-like and fibronectin (FN) type III repeats. These motifs are found in neural cell adhesion molecules [14]where they are involved in homophilic binding [45]. A subset of the type II class, RPTPμ [22], RPTPκ [27], PCP-2 [63], RPTPπ [13]and RPTPψ [Banville et al., Genbank #U60289], share considerable amino acid similarity and contain a MAM domain near the N-terminal. The high degree of similarity in the nucleotide sequences of PCP-2, RPTPπ and RPTPψ suggest that they represent the same gene. Both RPTPμ 5, 24and RPTPκ [49]have been shown to mediate cell–cell aggregation by homophilic binding.
Several RPTPs have been shown to play critical roles in neural development 10, 15, 46, 47, 54, 62. Transfection of PTPα into embryonic stem cells induces differentiation into functional neurons [15]. PTPNE3/PTPσ is highly expressed in the olfactory epithelium where it is likely to play a role in neuronal proliferation or migration 46, 62, 65. RPTPs containing carbonic anhydrase domains have been shown to be chondroitin sulfate proteoglycans [1]. One such molecule, RPTPζ/β, specifically binds contactin, a glycosylphosphatidylinositol-anchored neuronal recognition molecule [42], and the domain responsible for this binding acts as a substrate for neuronal adhesion and induction of neurite outgrowth. RPTPζ/β is expressed in glial cells in the developing central nervous system [10]where it may act as a signal transducer as neurons migrate along glial pathways. Phosphacan, an RPTPζ/β splice variant, has been shown to bind N-CAM, Ng-CAM and tenascin, again suggesting a role for RPTPs in the regulation of neuronal cell adhesion [33]. Furthermore, analysis of RPTP mutations in Drosophila provide strong evidence that PTP69D, PTP99A, and DLAR are involved in motor axon guidance 16, 29: Mutants lacking these RPTPs display `bypass', `detour', or `stall' phenotypes, indicating an impaired ability to execute correct axonal pathfinding decisions.
Here we describe the cDNA cloning, characterization, chromosomal mapping and expression of RPTPρ, a new member of the RPTPμ/κ subfamily of receptor protein tyrosine phosphatases. Unlike the majority of RPTPs, the expression of the RPTPρ transcript is entirely restricted to the brain and spinal cord of adult and developing animals.
Section snippets
Identification of RPTPρ
Primers originally designed to amplify the dystroglycan gene [26]between 1090–1371 bp, amplified a portion of RPTPρ cDNA. Total RNA from human frontal cortex [12]was reverse transcribed and used as a template for RT-PCR. The reaction contained 125 nM of each primer (5′GAATTCGGGAAGCCCACGGTCACCACTCGG3′ and 5′GTCGACTCCTGGGTGTCCGTGGCTTCTTGGT3′), 2.5 mM MgCl2, 200 μM each dNTP, 1× Taq DNA polymerase buffer, and 0.5 U Taq DNA polymerase (Gibco BRL) and was run for 35 cycles of 94°C for 30 s, 55°C for
Identification of RPTPρ
Analysis of RT-PCR products amplified from frontal cortex cDNA with a dystroglycan primer set revealed the expected portion of dystroglycan and an additional 650 bp product. Sequence analysis of the latter product revealed a high degree of amino acid identity with RPTPμ and RPTPκ, members of the type II class of receptor-like protein tyrosine phosphatases. The RPTPρ cDNA fragment was used to screen cDNA libraries to obtain overlapping phage clones.
Molecular cloning of RPTPρ
Four overlapping cDNA clones containing the
Discussion
The present studies describe the structure, chromosomal localization and expression pattern of RPTPρ, a new member of the type II family of receptor-like protein tyrosine phosphatases. Like other members of this group, the RPTPρ molecule is comprised of an extracellular region, a single transmembrane segment, and an intracellular catalytic region containing two phosphatase domains. The presence of a MAM domain in the extracellular segment further classifies RPTPρ as a member of a smaller group
Acknowledgements
Supported by AR40015 (AB), MH57415 (AR) and NS32276 (AF) from the National Institutes of Health, the Muscular Dystrophy Association (AB), and the Paul Patton Memorial Trust (RAW). The authors would like to thank G. Grumbling, S. Ingraham, J. Evans, and S. Han for their assistance, and L. Rowe and M. Barter of the Jackson Laboratory for analyzing the linkage data.
References (68)
- et al.
Receptor tyrosine phosphatase β is expressed in the form of proteoglycan and binds to the extracellular matrix protein tenascin
J. Biol. Chem.
(1994) Mammalian subtilisins: the long-sought dibasic processing endoproteases
Cell
(1991)- et al.
Protein tyrosine phosphatases: from structure to function
Trends Cell Biol.
(1994) - et al.
Identification of the homophilic binding site of the receptor protein tyrosine phosphatase PTPμ
J. Biol. Chem.
(1994) - et al.
Protein tyrosine phosphatases as adhesion receptors
Curr. Opin. Cell Biol.
(1995) - et al.
The expression of a novel receptor-type tyrosine phosphatase suggests a role in morphogenesis and plasticity of the nervous system
Dev. Brain Res.
(1993) - et al.
A YAC contig of the region containing the spinal muscular atrophy (SMN) gene: identification of an unstable region
Genomics
(1994) - et al.
Receptor tyrosine phosphatases are required for motor axon guidance in the Drosophila embryo
Cell
(1996) - et al.
A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity
Anal. Biochem.
(1983) - et al.
Cloning, expression, and chromosomal localization of a new putative receptor-like protein tyrosine phosphatase
FEBS
(1991)
Cell–cell adhesion mediated by a receptor-like protein tyrosine phosphatase
J. Biol. Chem.
The transmembrane tyrosine phosphatase DLAR controls motor axon guidance in Drosophila
Cell
The cloning of a receptor-type protein tyrosine phosphatase in the central nervous system
J. Biol. Chem.
Alternative splicing gives rise to a nuclear protein tyrosine phosphatase in Drosophila
J. Biol. Chem.
Protein tyrosine phosphatases: characterization of extracellular and intracellular domains
Curr. Opin. Genet. Dev.
Protein tyrosine phosphatases in signal transduction
Curr. Opin. Cell Biol.
cDNA cloning and characterization of a novel receptor-type protein tyrosine phosphatase expressed predominantly in the brain
J. Cell. Biol.
Genomic organization of human LAR protein tyrosine phosphatase gene and alternative splicing in the extracellular fibronectin type-III domains
J. Biol. Chem.
Alternative splicing in a novel tyrosine phosphatase gene (DPTP4E) of Drosophila melanogaster generates two large receptor-like proteins which differ in their carboxyl termini
J. Biol. Chem.
Cloning and expression of two structurally distinct receptor-linked protein tyrosine phosphatases generated by RNA processing from a single gene
J. Biol. Chem.
Homology of a domain of the growth hormone/prolactin receptor family with type III modules of fibronectin
Cell
The carbonic anhydrase domain of receptor tyrosine phosphatase β is a functional ligand for the axonal recognition molecule contactin
Cell
The anticoagulation factor protein s and its relative, gas 6, are ligands for the tyro 3/axl family of receptor protein kinases
Cell
Isoforms of a novel cell adhesion molecule-like protein tyrosine phosphatase are implicated in neuronal development
Mech. Dev.
The A5 antigen, a candidate for the neuronal recognition molecule, has homologies to complement components and coagulation factors
Neuron
Demonstration of protein tyrosine phosphatase activity in the second of two homologous domains of CD45
J. Biol. Chem.
A novel receptor-type protein tyrosine phosphatase is expressed during neurogenesis in the olfactory neuroepithelium
Neuron
A novel receptor tyrosine phosphatase-σ that is highly expressed in the nervous system
J. Biol. Chem.
Homophilic interactions mediated by receptor tyrosine phosphatases μ and κ
J. Biol. Chem.
An adhesive domain detected in functionally diverse receptors
Trends Biochem. Sci.
The receptor tyrosine kinase Ark mediates cell aggregation by homophilic binding
Mol. Cell Biol.
Homophilic binding of PTPμ, a receptor-type protein tyrosine phosphatase, can mediate cell–cell aggregation
J. Cell Biol.
Receptor protein tyrosine phosphatase PTPμ associates with cadherins and catenins in vivo
J. Cell Biol.
Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease
Biochem.
Cited by (28)
Expression analysis of genes located within the common deleted region of del(20q) in patients with myelodysplastic syndromes
2019, Leukemia ResearchCitation Excerpt :In the present study, expression of PTPRT and WISP2 genes was nearly absent in both controls and MDS patients. Previous study showed that expression of the PTPRT gene is restricted in central nervous system in adult [11]. Expression of the WISP2 gene is various among organs and tissues, and almost absent in bone marrow [12].
Regulation of development and cancer by the R2B subfamily of RPTPs and the implications of proteolysis
2015, Seminars in Cell and Developmental BiologyCitation Excerpt :R2B phosphatases are only found in vertebrates, suggesting they evolved to control processes unique to higher organisms [9]. The first R2B identified was PTPμ (also known as PTPmu, PTPRM and RPTPM) [10], followed by PTPκ (PTPkappa and PTPRK) [11], PCP-2 (PTPpi, PTPpsi, PTPλ, hPTP-J, PTPRO and PTPRU) [12], and PTPρ (PTPrho and PTPRT) [13]. Because of the presence of the CAM-like extracellular domains, R2B PTPs were evaluated for their ability to mediate cell–cell adhesion.
Intracellular substrates of brain-enriched receptor protein tyrosine phosphatase rho (RPTPρ/PTPRT)
2006, Brain ResearchCitation Excerpt :In the intracellular segment, a juxtamembrane region followed by two phosphatase domains suggests that, like other RPTPs, RPTPρ plays a role in signal transduction via protein dephosphorylation. In the mouse, RPTPρ is expressed predominantly in the central nervous system where it is developmentally regulated: Cerebral cortex, olfactory bulb and hippocampus contain very high levels perinatally; expression becomes markedly downregulated during postnatal week two (McAndrew et al., 1998b). A more detailed study of the cerebellum (McAndrew et al., 1998a) showed that the transcript is entirely restricted to anterior cerebellar lobules 1–6, and is completely absent in lobules 7–10.
Expression of receptor protein tyrosine phosphatases in embryonic chick spinal cord
2000, Molecular and Cellular NeurosciencesA retrospective analysis of phosphatase catalytic subunit gene variants in patients with rare disorders identifies novel candidate neurodevelopmental disease genes
2023, Frontiers in Cell and Developmental Biology