Influence of diet restriction on NMDA receptor subunits and learning during aging
Introduction
Memory is one of the earliest of the cognitive functions to show declines during the aging process [1]. Memory deficits associated with aging are seen in humans and non-human primates (see reviews [16], [17]), dogs [20] and rodents [6], [14], [50], [63]. The N-methyl-d-aspartate (NMDA) receptor, a subtype of glutamate receptors, is particularly important in learning and memory functions [10], [33]. NMDA antagonists inhibit memory performance [2], [21], [39], [43] and block the initiation of long-term potentiation in the hippocampus [8], [19], [43] and neocortex [5]. These studies suggest that detrimental changes to the NMDA receptor during the aging process should impact negatively on memory functions.
Aging animals do exhibit declines in NMDA receptor binding densities and functions, including memory-related functions. NMDA-stimulated release of transmitters is decreased with increasing age [18], [48]. Long-term potentiation is also altered in aged rodents [7], [11]. Age-related declines in binding of glutamate and [( ± )-2-carboxypiperazin-4-yl] propyl-1-phosphonic acid (CPP) to NMDA binding sites have been reported in mice, rats, and monkeys [26], [34], [45], [54], [58]. Humans also exhibit declines with increased age in binding of [3H]MK801 to the NMDA receptor complex in the frontal cortex [46]. Changes in NMDA binding sites during aging have been correlated with poor performance in reference memory tasks, such as the Morris water maze, in both frontal cortical regions [32] and in the hippocampus [32], [45].
Functional subunits of the NMDA receptor complex have been cloned for rats [25], [40], [42] and mice [23], [28], [38], [61]. The zeta1 (ζ1; rat NR1) subunit has the same distribution as NMDA-displaceable [3H]glutamate binding [38], [42], [44]. The four members of the epsilon family of subunits, ϵ1–4 (rat NR2A-D), in the mouse [23], [28], [38] each provide different agonist/antagonist affinities to ζ1/ϵ heteromeric receptors [28], [61]. These ϵ subunits also produce different gating behaviors, responses to Mg++, and I/V curves [25], [40]. We have found that the density of mRNA expression for the ϵ2 subunit declines with increasing age in the cerebral cortex and dentate gyrus [34]. These changes in ϵ2 mRNA expression correlate significantly with age-related changes in binding of agonist to NMDA sites across brain regions [34]. There is also an overall decrease in mRNA expression of the ζ1 subunit, but to a lessor degree than seen with the ϵ2 subunit [34]. It is not known whether these changes are responsible for the relationship between age-related declines in binding to the NMDA transmitter site and learning.
Dietary restriction is an intervention into the aging process that increases both the median and maximum life spans of laboratory animals, apparently by delaying the effects of aging [37], [56], [62]. This intervention has also been shown to prevent or decrease age-associated declines in spatial memory [3], [22], [47] and complex maze [24] performance. We have seen a slight improvement of performance in the Morris water maze with dietary restriction in C57Bl/6 mice [32].
The purpose of the present study was to determine whether any of the age-related changes in the expression of mRNA for the subunits of the NMDA receptor complex are related to the memory declines that are seen during aging in these mice. We utilized the intervention of dietary restriction in this study in order to determine whether the improved learning ability in the diet restricted animals was associated with an enhanced expression of NMDA subunits as compared to that found in ad libitum-fed mice.
Section snippets
Animals
Forty-two male C57Bl/6N-NIH mice were obtained from the National Institute on Aging’s animal colonies. The animals represented five groups, including three age groups (3, 15, and 26–27 month olds) and two diet groups (ad libitum-fed and diet restricted) in the following breakdown: twelve each of 3 month old ad libitum-fed and 26 month old diet restricted mice and six each of the 15 and 27 month old ad libitum-fed and 15 month old diet restricted mice. The diet restricted animals were restricted
Tissue handling
Thirty-nine mice were sacrificed 24 h after the last behavioral trial by exposure to CO2, followed by decapitation. Three mice died during the period of the behavioral trials. The brains and performance of these three animals were not used. Brains were removed, frozen in dry ice, and stored at −70°C. Horizontal 20 μm sections were obtained with a Microm HM500 cryostat (Zeiss, Thornwood, NY) and cold mounted onto gelatin-coated glass slides. Each slide contained a section from each age and diet
In situ hybridization
In situ hybridization was performed as previously described [34]. Oligonucleotides were commercially prepared (Macromolecular Resources, Colorado State University, Fort Collins, CO) for the ζ1 (Probe sequence: 5′ GCACAGCGGGCCTGGTTCTGGGTTGCGCGAGCGCGACCACCTCGC; complimentary to nucleotide residues -54 to -10), ϵ1 (5′ CCCTGAAACACATAGTTACTGAGACTATCCTTGTGCCTGTTGGCC; 2901 to 2945), and ϵ2 (5′ CACTGTAGCGGTCACTCTTGAAAGAGAACTTGCCGTACAGGTCGC; 3107 to 3151) subunits of the mouse NMDA receptor [57]. Probes
NMDA-displaceable [3H]glutamate binding assay
Binding was performed as previously described [31]. Slides were preincubated in cold (4°C) 50 mM Tris acetate (TA) buffer (pH 7.0) for 30 min, followed by 2 × 10 min incubations in warm TA buffer (30°C, pH 7.0). Sections were then incubated in a solution of 100 nM [3H]L-glutamate (New England Nuclear, Boston, MA), 1 μM kainate, 5 μM AMPA, and 100 μM 4-acetamido-4′-isothiocyanotostilbene-2,2′-disulfonic acid (SITS) for 10 min at 4°C. Slides were rinsed in 4 changes of TA buffer (4°C) for a total
Statistical analysis
Comparisons were made between 5 age/diet groups, because there were no 3 month old diet restricted animals. Performances in place and reversal platform trials were averaged over 5 trials (i.e. 2 days). Performance in the water maze task was analyzed by ANOVA, followed by Fisher’s modified LSD post-hoc tests for unequal sample sizes using SPSS software. The binding and mRNA data were normalized between assays as previously described [31], in order to decrease variability due to different batches
Behavioral testing
There was a significant effect of age/diet group, F(4,34) = 5.19, P = 0.002, and blocks of trials, F(5,170) = 33.39, P < 0.001, on cumulative proximity in the place platform trials, but no significant interaction between age/diet group and blocks of trials, F(20,170) = 0.93, P = 0.553 (Fig. 1 A,2A; trial blocks 1–6). Across all of the blocks of place platform trials, the 27 month old ad libitum-fed mice had a significantly greater cumulative proximity than all other groups (Fig. 2 A). There
Major findings
Dietary restriction significantly improved learning ability for the oldest mice in the Morris water maze, based on performance both in place and probe trials, and induced a slight improvement in NMDA-displaceable [3H]glutamate binding in several regions. The mRNA for the ϵ2 subunit of the NMDA receptor complex showed changes between young and old ad libitum-fed mice within the most brain regions, however, diet restriction did not improve the expression significantly. Rather, it was the ζ1
Conclusion
Diet restriction had a strong influence on improving learning and memory performance in older C57Bl/6 mice in this study. It also was associated with an improvement in NMDA receptors, but to a lesser degree. This improvement did not appear to be due to an enhancement in the expression of the e2 subunit, which showed the most declines in mRNA expression with increased age. Instead, in a few regions, it appeared to be due to the relationship between changes in mRNA expression for the ϵ1 subunit
Acknowledgements
I would like to thank Dr. Scott Nelson for technical advice on the project, Ginger Sammonds, Heidi Wampler, and Sarah Zimmerman for their technical assistance with the in situ hybridization, binding and image analysis and Dr. Kenneth Shiarella for his work on the behavioral testing. This research was supported by awards AG10607, AG00659, AG16322 and AG05619 from the National Institute on Aging at the National Institutes of Health.
References (63)
- et al.
Effects of ketamine on tunnel maze and water maze performance in the rat
Behav Neural Biol
(1989) - et al.
Age-related ability of rats kept on a life-long hypocaloric diet in a spatial memory test. Longitudinal observations
Neurobiol Aging
(1991) - et al.
Selective effects of hippocampal and frontal cortex lesions on a spatial learning problem in two inbred strains of mice
Behav Brain Res
(1982) Aging and the physiology of spatial memory
Neurobiol Aging
(1988)- et al.
Caloric restriction and spatial learning in old mice
Physiol Behav
(1996) - et al.
Age-related alterations in potentiation in the CA1 region in F344 rats
Neurobiol Aging
(1993) - et al.
Caloric restriction prevents age-related deficits in LTP and in NMDA receptor expression
Mol Brain Res
(2000) - et al.
Spatial learning and motor deficits in aged rats
Neurobiol Aging
(1984) - et al.
Animal models of normal agingRelationship between cognitive decline and markers in hippocampal circuitry
Behav Brain Res
(1993) - et al.
N-methyl-d-aspartate mediated responses decrease with age in Fischer 344 rat brain
Neurobiol Aging
(1991)