Journal of Molecular Biology
Cooperative Binding of Tetrameric p53 to DNA
Introduction
The p53 tumour suppressor gene is the most frequently mutated gene in cancer known to date, with p53 mutations occurring in over half of all human tumours.1., 2. The vast majority of these mutations occur in the sequence-specific DNA-binding domain, underscoring the importance of DNA binding in the ability of p53 to maintain genomic stability.3 When cells are exposed to a variety of stresses such as UV light, hypoxia, DNA damage, and heat shock, p53 binds to a consensus sequence present in a variety of genes, which leads to p53-mediated transcriptional activation. Ultimately, cells then undergo cell cycle arrest, DNA repair, or apoptosis.4., 5.
Wild-type p53 is a sequence-specific transactivator,6 which binds to a double-stranded DNA consensus site containing two copies of the “half-site” decameric motif RRRC(A/T)|(T/A)GYYY separated by up to 13 base-pairs (bp).7., 8. In this sequence, R and Y represent purines and pyrimidines, respectively, and the vertical bar indicates the centre of symmetry within the half-site. The full-length consensus sequence contains two half-sites, which can alternatively be viewed as four inverted 5 bp quarter sites (→← →←). The crystal structure of p53 bound to DNA showed that the central p53 core binding domain can bind to each quarter site.9 Studies later verified that four molecules of p53 core domain bind to the full-length recognition element,10., 11. and that dimers of p53 bind to adjacent 10 bp half sites, and not alternating quarter sites.12
Even though the isolated p53 core domain can bind DNA in a sequence-specific manner, it is thought that tetramerization of p53 is a requirement for formation of a stable p53–DNA complex and subsequent transactivation of target genes.12., 13., 14. The oligomerization domain of p53 spans residues 320–360 and forms a tetramer composed of a dimer of dimers. Each dimeric subunit contains an antiparallel two-strand beta-sheet and two alpha-helices. The tetramer forms through hydrophobic packing between the helices, forming a four-helix bundle.15., 16., 17., 29. Mutation of this hydrophobic core has been shown to inhibit tetramerization.18 Stability studies on the tetramerization domain show that there is a transition between four monomers to the native tetramer,19., 20. while folding studies on the tetramerization domain uncovered the existence of a dimeric intermediate.21 This, along with in vitro transcription/translation experiments suggests that the formation of the dimeric subunit is faster than tetramer formation, and that tetramerization is concentration-dependent.13 These data raise the question as to whether the functional unit of p53 in DNA binding is the monomer, dimer, or tetramer and how this affects DNA binding.
The formation of a tetrameric p53–DNA complex is critical for the ability of p53 to function as a tumour suppressor. While individual core domains are able to bind to half-site recognition elements, it has been shown that this mode of binding is insufficient to activate transcription of p53 target genes.22 Studies have shown that the binding of monomeric p53 core domain to its full-length binding sequence is highly cooperative and is associated with the bending of DNA,11 which is believed to facilitate the architectural accommodation of four p53 molecules to a recognition element.23 Bending of the p53 DNA recognition element has also been shown to play a role in modulating p53 affinity to its target sequences and in stabilizing the nucleoprotein complex.24., 25., 26.
Here, we investigated the DNA binding of oligomeric p53 to specific DNA using fluorescence anisotropy and analytical ultracentrifugation (AUC). We demonstrate that the binding of oligomeric p53 to DNA in solution does have 4 : 1 stoichiometry. This interaction is highly cooperative, and relies on the recognition of DNA sequences by the core domain and on the tetramerization of the protein, which is heavily mediated by DNA. We also show that only 4 : 1 complexes of p53 to DNA are stable, suggesting that protein–protein interactions27., 28. and intrinsic properties of the full-length p53 DNA binding element, such as DNA bending, are critical in the formation of a biologically active tetrameric p53–DNA complex.
Section snippets
p53CT WT is in equilibrium between dimers and tetramers while p53CT L344A is only a dimer in solution
In order to analyse the DNA binding of p53, it was first necessary to determine the oligomerization states of p53CT and its L344A mutant in solution. p53CT (residues 94 to 360) is a truncation mutant of p53 containing the sequence-specific core DNA binding and oligomerization domains. Using sedimentation equilibrium AUC, we showed that p53CT exists as dimers and tetramers in solution while the L344A mutant only forms dimers under comparable concentrations. The data for p53CT was first fit to a
Specific binding of p53 to DNA is highly cooperative
We have demonstrated that p53CT, a truncation mutant containing the core DNA binding and oligomerization domains (residues 94 to 360), binds DNA in a highly cooperative manner. Wild-type p53CT is in equilibrium between its dimeric and tetrameric forms, with a dimer–tetramer equilibrium constant (KD–T) of 3.2(±1.4) μM. Thus, at sub-micromolar concentrations of p53, which are sufficient for high affinity specific DNA binding, the wild-type protein exists predominantly as a dimer, making it the
Conclusions
Using fluorescence anisotropy and analytical ultracentrifugation, we were able to show that specific p53 binding to DNA is a highly cooperative and specific interaction. p53 containing the oligomerization domain is in equilibrium between dimers and tetramers in solution, but the presence of a specific p53 DNA binding sequence dramatically increases the tetramerization of the protein. Tetrameric p53 binds specific DNA with nM affinity and has a Hill coefficient of 1.8, indicative of a highly
Cloning
The gene encoding for amino acid residues 94–360 of human p53 was amplified from pT7hp5341 using the primers 5′-CGCGGATCCTCATCTTCTGTCCCTTCCCAG AAAACCTACCAGGGC-3′ and 5′CCGGAATTCACCCTGGCTCCTTCCCAGCCTGGGC ATCCTTGAGTTCCA-3′. The gene encoding for amino acid residues 94–312 of human p53 was amplified using the primers 5′-CGCGGATCCTCATCTTCTGTCCCTTCCCAGAAAACCTACCAGGGC-3′ and 5′-CCGGAATTCAGGTGTTGTTGGGCAGTGCTCG-3′. The PCR products were digested with BamHI and HindIII, purified and inserted into a
Acknowledgements
R.L.W. is supported by a Howard Hughes Medical Institute Predoctoral Fellowship. We thank Mark Bycroft for his helpful discussions.
References (46)
p53, the cellular gatekeeper for growth and division
Cell
(1997)- et al.
Biogenesis of p53 involves cotranslational dimerization of monomers and posttranslational dimerzation of dimers
J. Biol. Chem.
(2002) - et al.
Architectural accommodation in the complex of four p53 DNA binding domain peptides with th p21/waf1/cip1 DNA response element
J. Biol. Chem.
(1997) - et al.
DNA bending is essential for the site-specific recognition of DNA response elements by the DNA binding domain of the tumor suppressor protein p53
J. Biol. Chem.
(1997) - et al.
NMR spectroscopy reveals the solution dimerzation interface of p53 core domains bound to their consensus DNA
J. Biol. Chem.
(2001) - et al.
Recognition of DNA by p53 core domain and location of intermolecular contacts of cooperative binding
J. Mol. Biol.
(2002) - et al.
Ion effects on ligand–nucleic acid interactions
J. Mol. Biol.
(1976) - et al.
Analysis of equilibrium and kinetic measurements to determine thermodynamic origins of stability and specificity and mechanism of formation of site-specific complexes between proteins and helical DNA
Methods Enzymol.
(1991) - et al.
Affinity and specificity of trp repressor–DNA interactions studied with fluorescent oligonucleotides
J. Mol. Biol.
(1997) - et al.
Characterization of charge change super-repressor mutants of trp repressor: effects on oligomerization conformation, ligation and stability
J. Mol. Biol.
(1996)
Over-production of proteins in Escherichia coli: mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels
J. Mol. Biol.
Database of p53 gene somatic mutations in human tumors and cell lines
Nucl. Acids Res.
Somatic point mutaions in the p53 gene of human tumors and cell lines: updated compilation
Nucl. Acids Res.
Sequence-specific transcriptional activation is essential for growth suppression by p53
Proc. Natl Acad. Sci. USA
Live or let die: the cell's response to p53
Nature Rev. Cancer
Presence of a potent transcription activating sequence in the p53 protein
Science
Definition of a consensus binding site for p53
Nature Genet.
A transcriptionally active DNA-binding site for human p53 protein complexes
Mol. Cell. Biol.
Crystal structure of a p53 tumor suppressor–DNA complex: understanding tumorigenic mutations
Science
Interaction of p53 with Its consensus DNA-binding site
Mol. Cell. Biol.
Four p53 DNA-binding domain peptides bind natural p53-response elements and bend the DNA
Proc. Natl Acad. Sci. USA
How p53 binds DNA as a tetramer
EMBO J.
p53 DNA binding can be modulated by factors that alter the conformational equilibrium
EMBO J.
Cited by (200)
Cancer-related Mutations with Local or Long-range Effects on an Allosteric Loop of p53
2022, Journal of Molecular BiologyThe p53 network: cellular and systemic DNA damage responses in cancer and aging
2022, Trends in GeneticsThe potential roles of p53 signaling reactivation in pancreatic cancer therapy
2022, Biochimica et Biophysica Acta - Reviews on CancerMechanistic roles of mutant p53 governing lipid metabolism
2022, Advances in Biological Regulation