Research ArticleInvolvement of the catalytic subunit of protein kinase A and of HA95 in pre-mRNA splicing
Introduction
Protein kinase A (PKA) is considered the main target for cAMP in the cell and regulates a vast number of cellular processes such as metabolism, gene expression, cell growth and differentiation [1]. In the absence of cAMP, PKA is an inactive tetrameric holoenzyme consisting of two catalytic (C) subunits bound to a regulatory (R) subunit dimer, which is compartmentalized to distinct locations in the cell by A-kinase-anchoring proteins (AKAPs) [2]. AKAPs contribute to maintaining specificity of PKA-signaling, but it is also believed that several isoforms and splice variants of both R and C subunits are important mediators of specificity. In mammals, there are four genes encoding R-subunits, RIα, RIβ, RIIα and RIIβ, and four genes encoding C subunits, Cα, Cβ, Cγ and PrKX [1].
When four cAMP molecules bind the R subunits, the holoenzyme dissociates and the C subunits are released to phosphorylate a diverse number of cytosolic target substrates in the vicinity of the PKA holoenzyme. However, upon activation, a proportion of the C subunit translocates to the nucleus [3], [4]. The major targets for C subunit phosphorylation in the nucleus are a group of cAMP-responsive nuclear factors, which bind and regulate the expression of genes containing cAMP-responsive elements (CREs), called CRE-binding proteins (CREBs) [5]. The understanding of how specificity of the nuclear C is maintained is sparse; however, it is expected that temporal and spatial regulation may involve C subunit targeting to nuclear structures independently of the R subunit. This is supported by recent reports demonstrating that the C subunit associates with the nuclear proteins AKIP (A-kinase interacting protein) [6] and HA95 [7].
In this paper, we show that both Cα and Cβ are localized to splicing factor compartments (SFCs), where they co-localize with the C subunit-binding protein HA95, and not AKIP. Furthermore, we demonstrate that the C subunits, as well as HA95, are involved in pre-mRNA splicing, possibly through a cAMP-independent mechanism.
Section snippets
Expression plasmids
Plasmid encoding full-length native Cα1 in the mammalian expression vector pEF-DEST 51 has been described previously [8]. This plasmid was also used for generation of a catalytically inactive mutant by altering lysine 73 to a methionine (Cα1K73M) [9]. This was done using the QuickChange mutagenesis kit (Stratagene, La Jolla, CA, USA) according to manufacturer's protocol using the following primers: Sense; 5′GAACCACTATGCCATGATGATCCTCGACAAACAGA and Antisense; 5′TCTGTTTGTCGAGGATCATCATGGCATAGTGGTTC
PKA C subunits are localized in nuclear spots
A fraction of the PKA C subunit, when not bound to the R subunit, is located in the nucleus of eukaryotic cells [3], [4]. However, few reports demonstrate specific targeting of the C subunit within the nucleus. Immunofluoresence (IF) analysis of the teratocarcinoma cell line NT2 using a pan-C antibody (anti-Cα, see Materials and methods) revealed a diffuse staining in the cytoplasm as well as the nucleus after paraformaldehyde (PF) fixation (Fig. 1A, upper panel). Additionally, a distinct
Discussion
In the present report we show that the C subunit is localized to SFCs in the nucleus. We also demonstrate that catalytically active C subunits regulate alternative splice site selection in vivo. Furthermore, the C subunit-binding protein HA95 is also localized to SFCs and affects the E1A splicing pattern. Interestingly, neither SFC localization of C nor the E1A splicing pattern was affected by cAMP stimulation. This may imply that cAMP-independent mechanisms are involved in PKA-mediated
Acknowledgments
We would like to thank Dr. Adrian Krainer, Cold Spring Harbor Laboratory, NY, USA for providing plasmid encoding the E1A reporter gene (pMTE1A), Dr. Susan Taylor, Department of Chemistry and Biochemistry, Howard Hughes Medical Institute, University of California, San Diego, USA for providing rabbit polyclonal anti-AKIP1, Dr. Gerald Thiel for providing plasmid encoding FLAG®-tagged Cα1 containing an NLS signal and Tove Myhre, Department of Pediatric Research, University of Oslo, Norway for
References (41)
- et al.
The transcriptional activity of NF-kappaB is regulated by the IkappaB-associated PKAc subunit through a cyclic AMP-independent mechanism
Cell
(1997) - et al.
Identification, cloning and characterization of a novel nuclear protein, HA95, homologous to A-kinase anchoring protein 95
Biol. Cell
(2000) - et al.
Molecular and behavioral effects of a null mutation in all PKA C beta isoforms
Mol. Cell. Neurosci.
(2002) - et al.
Identification, purification, and characterization of subunits of cAMP-dependent protein kinase in human testis. Reverse mobilities of human RII alpha and RII beta on sodium dodecyl sulfate-polyacrylamide gel electrophoresis compared with rat and bovine RIIs
J. Biol. Chem.
(1992) Assays of protein kinase
Methods Enzymol.
(1983)- et al.
Cyclic-AMP-dependent protein kinase type II is associated with the Golgi complex and with centrosomes
Cell
(1985) - et al.
Differential localization of protein kinase A type II isozymes in the Golgi-centrosomal area
Exp.Cell Res.
(1999) - et al.
The major catalytic subunit isoforms of cAMP-dependent protein kinase have distinct biochemical properties in vitro and in vivo
J. Biol. Chem.
(1996) - et al.
Sphingosine activates protein kinase A type II by a novel cAMP-independent mechanism
J. Biol. Chem.
(2005) - et al.
Molecular cloning, chromosomal localization, and cell cycle-dependent subcellular distribution of the A-kinase anchoring protein, AKAP95
Exp.Cell Res.
(1998)
A novel shuttle protein binds to RNA helicase A and activates the retroviral constitutive transport element
J. Biol. Chem.
Mapping the functional domains of HAP95, a protein that binds RNA helicase A and activates the constitutive transport element of type D retroviruses
J. Biol. Chem.
Specificity in the cAMP/PKA signaling pathway. Differential expression, regulation, and subcellular localization of subunits of PKA
Front. Biosci.
AKAP signalling complexes: focal points in space and time
Nat. Rev., Mol. Cell Biol.
Rapid and reversible translocation of the catalytic subunit of cAMP-dependent protein kinase type II from the Golgi complex to the nucleus
EMBO J.
Movement of the free catalytic subunit of cAMP-dependent protein kinase into and out of the nucleus can be explained by diffusion
Mol. Biol. Cell
Transcriptional regulation by cyclic AMP
Annu. Rev. Biochem.
A-kinase-interacting protein localizes protein kinase A in the nucleus
Proc. Natl. Acad. Sci. U. S. A.
Protein kinase A associates with HA95 and affects transcriptional coactivation by Epstein–Barr virus nuclear proteins
Mol. Cell. Biol.
Identification and characterization of novel PKA holoenzymes in human T lymphocytes
FEBS J.
Cited by (42)
Alzheimer disease therapeutics: Focus on the disease and not just plaques and tangles
2014, Biochemical PharmacologyActivation-induced cytidine deaminase (AID) is localized to subnuclear domains enriched in splicing factors
2014, Experimental Cell ResearchCitation Excerpt :An important AID regulator is the cAMP-dependent protein kinase A (PKA) that phosphorylates AID at Ser38 and stimulates its biological activity [1,43]. Interestingly, PKA is also involved in regulation of transcription and splicing [26]. It is predominantly localized in the cytoplasm, but a fraction of the catalytic α subunit (PKA-Cα) enters the nucleus and is targeted to nuclear speckles, likely by the Arg/Ser-rich splicing factor SFSR17A [22].
Cyclic AMP-dependent protein kinase regulates 9G8-mediated alternative splicing of tau exon 10
2012, FEBS LettersCitation Excerpt :Apart from regulation of transcription, little is known about the function of the C subunit in the nucleus. It is known that PKA phosphorylates several splicing factors and is involved in the pre-mRNA splicing, including tau pre-mRNA [21–23]. The role of PKA in the 9G8 mediated alternative splicing of tau exon 10 was unclear.
Splicing alterations in pancreatic ductal adenocarcinoma: a new molecular landscape with translational potential
2023, Journal of Experimental and Clinical Cancer Research