Figures
Abstract
Intramembrane proteases of the Signal Peptide Peptidase (SPP) family play important roles in developmental, metabolic and signaling pathways. Although vertebrates have one SPP and four SPP-like (SPPL) genes, we found that insect genomes encode one Spp and one SppL. Characterization of the Drosophila sppL gene revealed that the predicted SppL protein is a highly conserved structural homolog of the vertebrate SPPL3 proteases, with a predicted nine-transmembrane topology, an active site containing aspartyl residues within a transmembrane region, and a carboxy-terminal PAL domain. SppL protein localized to both the Golgi and ER. Whereas spp is an essential gene that is required during early larval stages and whereas spp loss-of-function reduced the unfolded protein response (UPR), sppL loss of function had no apparent phenotype. This was unexpected given that genetic knockdown phenotypes in other organisms suggested significant roles for Spp-related proteases.
Citation: Casso DJ, Liu S, Biehs B, Kornberg TB (2012) Expression and Characterization of Drosophila Signal Peptide Peptidase-Like (sppL), a Gene That Encodes an Intramembrane Protease. PLoS ONE 7(3): e33827. https://doi.org/10.1371/journal.pone.0033827
Editor: Maria Gasset, Consejo Superior de Investigaciones Cientificas, Spain
Received: March 18, 2011; Accepted: February 20, 2012; Published: March 16, 2012
Copyright: © 2012 Casso et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The work was funded by National Institutes of Health grant #GM077407. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Transmembrane segments of integral membrane proteins can be cleaved by Intramembrane Cleaving Proteases (I-CLiPs; reviewed in) [1]. These integral membrane proteins are remarkable enzymes, with catalytic sites situated within the lipid bilayer. Known I-CLiPs have been categorized into four families: γ-secretase aspartyl proteases, rhomboid serine proteases, Site 2 Proteases (S2P), and signal peptide peptidase (SPP) aspartyl proteases. I-CLiPs carry out essential steps in metabolic and cell signaling pathways, including activation of Notch by Presenilin, the aspartyl protease in the γ-secretase complex [2], [3], [4], cleavage and release of the Drosophila EGF-like proteins by Rhomboids [5], and cleavage and activation of SREBP by Site-2 Protease (S2P) [6]. Mammalian SPP was first identified as an enzymatic activity that proteolyzes signal peptides generated by proteolysis in the endoplasmic reticulum (ER) [7], [8]. Its characterization has revealed that in addition to a role in housekeeping functions such as cleansing the membrane of signal peptides, it also cleaves substrates to release bioactive peptides from lipid bilayers. Substrates for SPP include HLA-E [9], hepatitis C virus polyprotein [10], preprolactin [11], and class I MHC heavy chains in cytomegalovirus infected cells [12]. The activities of Drosophila Spp are less well characterized, but a recent report identified Crumbs, a transmembrane protein controlling cell polarity and morphogenesis that has an unusually long signal peptide, as a target substrate [13].
Putative SPP homologs (“SPP-like” proteases (SPPLs)) have been identified in the genomes of mammals, amphibians, fish, insects, and nematodes, and related sequences have been found in rice, corn and Arabidopsis [8], [14]. Like SPPs, these proteins are characterized by a nine-transmembrane topology, an aspartyl diad (YD and GXGD) in the presumptive catalytic site situated within two transmembrane domains, and a PAL motif of unknown function near the carboxy terminus. Vertebrate genomes encode five SPP family members: SPP itself, and related proteins that have been named, SPPL2a/b/c and SPPL3. Fungal genomes also encode a fifth member, SPPL4. The SPP, SPPL2a/b/c and SPPL3 proteins all appear to have the same relative orientation, placing their catalytic sites in a similar manner within the membrane. This conserved orientation is consistent with the idea that all of these family members cleave type 2 transmembrane proteins by a similar process [15]. To date, target substrates have been identified for only the SPPL2 enzymes. These substrates are TNF-α, Bri2, and FasL [16], [17], [18], [19].
In addition to the biochemical approaches that have been taken to investigate the functions of SPP proteases, genetic studies have been carried out in C. elegans, D. rerio and D. melanogaster that have suggested several types of essential roles for SPP. RNAi knockdown of C. elegans IMP-2 (spp) caused embryonic lethality, abnormal larval molting, adult egg production defects and sterility [20]. In D. rerio, knockdown phenotypes for spp and sppl3 included neural lethality, and knockdown of sppl2b caused vasculature and blood abnormalities [21]. Reduction of spp function in A. thaliana compromised pollen formation [22].
We previously characterized the expression and genetics of the Drosophila spp gene [23]. Expression of spp was first detected in germ band extended embryos, and was present at higher levels in the proventriculus, salivary glands, and trachea of late embryos. The Spp protein localized to the ER. Loss-of-function alleles of Drosophila spp were isolated and found to have larval lethal phenotypes and defective tracheal development. Here, we report that the Spp family is conserved in eighteen insect genomes, each having one Spp and one SppL ortholog. We describe a genetic characterization of the sole Drosophila SppL-encoding gene, sppL (CG17370). We found that sppL is expressed broadly during early embryogenesis, and that its expression is elevated in mesodermal and midgut primordia in later embryos before waning to undetectable levels in late embryos. And in contrast to Spp, we found that SppL localizes to both the ER and Golgi. Finally, we describe the generation of null alleles of sppL and their characterization. Unexpectedly and in contrast to spp mutants, sppL loss of function has no apparent consequence on development or lifespan.
Methods
Cloning and expression of sppL
The sppL (CG17370, FBgn0039381) open reading frame was amplified from a 3–12 hour embryonic cDNA library [24] by PCR, using Vent DNA polymerase (New England Biolabs) and oligonucleotides oEcoRI-sppL-M-s (CCGGAATTCATGTCGCACGGTGGAGCC) and oXhoSppL-a (AAACTCGAGTCAGACTTCCAGTTGTTTTGATGG). The resulting PCR product was first subcloned into pCR2.1 (Invitrogen), creating pCR2.1-sppL and subsequently into pUAST [25], creating pUAS-sppL. Sequencing confirmed an exact match with the Genbank CG17370 sequence.
pUAS-myc-sppL in which a single amino-terminal myc tag was fused in-frame with the sppL initiating methionine was created using oligos oBgl2mycSPPL-s (AAAGATCTATGGAACAAAAACTTATTTCTGAAGAAGACCTGATGTCGCACGGTGGAGCCGGTGGCGG) and oXhoSppL-a. S2 cells were grown in Shields and Sang M3 media supplemented with 10% heat-inactivated fetal bovine serum, and co-transfected with pUAS-myc-sppL and pA5c-GAL4 [26] using Effectene (Qiagen). One of two marker plasmids was also included in each transfection: pA5cGG105 expressing a fusion of Calreticulin (Crc), GFP and the “KDEL” ER retention signal, which marks the ER only; or pA5cGG112 expression a fusion of KDEL Receptor (KdelR) with GFP, which marks the ER and Golgi. Imaging these cells was done as previously described [23].
In situ hybridization
In situ hybridizations were carried out as previously described [27] with a 1.2 kb anti-sense digoxygenin-labeled riboprobe for the entire sppL protein coding sequence. Embryos were from an overnight collection of y w flies.
Generation of sppL mutants
Flies carrying the P{lacW}l(3)SH116SH116 (FBal0143368) element [28] were obtained from the Szeged Drosophila Stock Center. For simplicity, we refer to this element as P{lacW}sppLsh116. The position and orientation of P{lacW}sppLsh116 in the large intron of sppL were determined by amplification and sequencing of the flanking genomic DNA. DNA was amplified from both sides of the P{lacW}sppLsh116 element with the following primer pairs: oEP3Pi (GAGTTAATTCAAACCCCACGGACATGCTAAGGG)+osppL-2000s (CGGCGGTGCTAATGTAGCGCATTTCACTG); and oEP5Pi (CTGACCTTTTGCAGGTGCAGCCTTCCACTGCG)+osppL-4000a (GTAATGAAAATAAAACTCAGAAACTGCGG). Pools of genomic DNA from progeny were generated after imprecise excision of P{lacW}sppLsh116, and products of PCR amplification using at least four primer pair combinations were tested. The sense primer on the left of the P element insertion site osppL-2000s corresponds to sequence between the P{lacW}sppLsh116 insertion site and exon N2. The four antisense primers to the right of the P element are separated by approximately 1 kb intervals and correspond to sequences: within the large intron (osppL-4000a); exon C1 (osppL-5000a, CATTTCGCTTCTTCTGCTCCCGCTCGCGG); within exon C4 (osppL-6000a, CAATGCCACCCAGATGCAACTTTCTGGCC); and the intergenic sequence between sppL and Lnk (osppL-7250a, GTTTGCAACGAACACATGCATTTTGGC). Genomic DNA was prepared from adult flies as described in [29].
Df(3R)sppL was created by recombination between FRT insertions PBac{RB}CG17370e00372 (FBti0047087) and PBac{XP}Lnkd07478 (FBti0042888) [30] which flank the sppL gene (according to) [31]. This deletion was verified both by amplification of DNA between the two PBac elements and by failure to amplify the sppL gene from the Df(3R)sppL genomic DNA.
Spp and SppL homology
D. melanogaster Spp and SppL protein sequences were used as queries for NCBI BLASTP [32]. Each sequence was used to identify related proteins both from databases of reference proteins (refseq_protein) and non-redundant protein sequences (nr) from each of the species listed in Table 1. Orthologs were identified as sequences with high amino acid identity throughout and BLASTP scores higher than 470; BLASTP scores comparing Spp to SppL sequences were between 100 and 150. Percent identities (Table 1) were calculated using CLUSTAL W [33]. The phylogram was created using CLUSTAL W2 [34] and TreeVector [35] by comparing sequences for insect Spp and SppL orthologs listed in Table 1 and human SPPSPPL2a (NP_116191), SPPL2b (NP_694533), SPPL2c (NP_787078), and SPPL3. Putative transmembrane domains were identified using the “TMHMM” and HMMTOP algorithms [36], [37] and by similarity to the model proposed by Friedmann et al. [15].
Unfolded Protein Response (UPR) assay
Embryos were collected from control flies (w1118), from two sppL lines (w1118, sppL57D/TM3 Kr-GFP, and, w1118, Df(3R)sppLBW1/TM3 Kr-GFP) and from a spp line (w1118, Df(2L)lwr14 p(lwr+)/CyO Kr-GFP) and from a double mutant spp, sppL line (w118, Df(2L)lwr14, p(lwr+)/CyO ActGFP, sppLBW1/TM6B armGFP) at 25°C. Egg-laying was for 24 hours, and larvae incubated for an additional 2.5 days at room temperature, at which point mutant larvae lacking GFP fluorescence were selected. Control and mutant larvae were cut in half longitudinally, turned inside out to expose internal tissues, and incubated at 25°C in Shields and Sang M3 Insect Medium supplemented with 10% heat-inactivated fetal bovine serum and penicillin-streptomycin. To induce the UPR, DTT (5 mM) was added to induce the ER stress response. To detect UPR-induced alternative splicing of the xbp1 transcript, total RNA was prepared after two hours of incubation in media using ZR RNA MicroPrep kit (Zymo) followed by treatment with DNase. cDNA was synthesized from 0.15 µg RNA using a High Capacity RNA-cDNA kit (Applied Biosystems). Thirty cycles of PCR amplification using Vent DNA Polymerase (New England Biolabs) with XbpI (CG9415, FBgn0021872) primers XBP-F (TCAGCCAATCCAACGCCAG) and XBP-R (CTGTTGTATACCCTGCGGCAG) were carried out using a 60°C annealing step. Products of 100 and 77 base pairs were resolved on 2% Omnipur low melting agarose (EM Scientific) gels, with the smaller band indicative of the UPR. Relative band intensities were measured using ImageJ.
Results
The SppL protein
In 2002, a search of sequence databases identified the I-CLiP family of presenilin homologs [14] that includes Drosophila CG11840 (spp) [23] and CG17370. We have investigated the CG17370 sequence and here show that it encodes a SPPL homolog. CG17370 is predicted to encode two proteins (417 and 422 residues) that could be derived by alternative splicing. These proteins have limited similarity to the 390 residue Drosophila Spp (24% identity with the 417 residue form of CG17370). However, several key features and regions in these proteins suggest their functional homology. Both Spp and CG17370 proteins have nine predicted transmembrane helices (Fig. 1), of which the four C-terminal helices that include the presumed catalytic domain have significant sequence homology (55% identity in this region; Figs. 1, 2). Sequence similarity is particularly high in the immediate vicinity of the catalytic YD and GXGD aspartyl diad, as well as near the distal PAL motif. The putative ER retention motif KKXX found at the carboxy-terminus of SPP proteins [8] is not conserved in CG17370 or SPPL3. The overall relatedness of human SPPL3 to the CG17370 protein (59% overall identity) is significantly higher than is the kinship of Drosophila Spp and CG17370 (24% identity). All nine predicted transmembrane helices are highly conserved between human SPPL3 and Drosophila CG17370 (80% identity; Fig. 2), and significant sequence similarity is also distributed in the non-transmembrane regions (46% identity). We henceforth refer to the CG17370 protein as SppL.
Three sequences are shown: Drosophila Spp (Dm Spp), Drosophila SppL (Dm SppL), and human SPPL3 (Hs SPPL3). Homologies between Dm Spp and Dm SppL, and between presumptive Dm SppL and Hs SPPL3 are indicated: for identity, by a letter; or for similarity, by a colon. Predicted transmembrane domains are highlighted in blue boxes and numbered TM1-TM9. The catalytic regions including the aspartyl diad and PAL motif are shown in red boxes. Dashed lines (—) indicate the extent of the sppL24J and sppL57D deletions.
Pair-wise comparisons of amino acid identity (%) are plotted for each of the nine predicted transmembrane (TM) domains. Comparisons between Drosophila SppL and Drosophila Spp are in blue; comparisons of Drosophila SppL and human SPPL3 are in red. Whereas strong identity exists between Drosophila SppL and human SPPL3 in all transmembrane domains (red), the region of strong identity between Spp and SppL (blue) is limited to the C-terminal four transmembrane domains (TM6-TM9) that include the catalytic domains [47].
The presence of just two members of the Spp family encoded in the genome of D. melanogaster contrasts with a larger family of five found in vertebrate genomes. To determine whether the two member Spp family is unique to the species melanogaster or is characteristic of the insects, we compared the Spp and SppL sequences from melanogaster to the predicted proteomes of ten other Drosophila species (D. ananassae, D. erecta, D. grimshawi, D. mojavensis, D. persimilis, D. pseudoobscura, D. sechellia, D. simulans, D. willistoni, and D. yakuba), to three species of mosquito (A. aegypti, C. quinquefasciatus, and A. gambiae), to a honeybee (A. mellifera), to a wasp (N. vitripennis), and to a beetle (T. castaneum). BLAST searches revealed that all seventeen genomes encode one Spp and one SppL protein. Similar searches identified all five Spp family members in the human genome. As shown in Table 1, the sequences of the SppL orthologs are strongly conserved between melanogaster and the other eleven Drosophila species, but the SppL orthologs are all distinct from melanogaster Spp. Spp orthologs have been similarly conserved and are distinct from melanogaster SppL. Conservation is also significant for the Spp and SppL orthologs in the other six insect genome sequences we analyzed. Comparison of D. melanogaster SppL to the H. sapiens sequences SPPL2a, SPPL2b, SPPL2c and SPPL3 revealed that only SPPL3 had significant sequence conservation (12%, 16%, 15% and 59% identity, respectively). And conservation of H. sapiens SPP and melanogaster Spp is highly significant (58%) while conservation of H. sapiens SPP and melanogaster SppL is less (29%). Note that the sequence conservation of D. melanogaster SppL and H. sapiens SPPL3 (59% identity) is almost as great as the similarity of D. melanogaster SppL to orthologs of non-Drosophila insects (70–79%) and far greater than the similarity between D. melanogaster SppL and Spp (24%). The sequence conservation of H. sapiens SPPL3 with SPPL2a/b/c is similarly low (13%, 16% and 16%, respectively). These data suggest that insects encode single species of Spp and SppL proteins, that H. sapiens SPPL3 is an ortholog of the insect SppL proteins, and that H. sapiens SPP is an ortholog of the insect Spp proteins. These relationships are apparent in the phylogram illustrated in Figure 3.
Sequences are marked with an abbreviation for the species (i.e., D. melanogaster SppL, Dmel-SppL; see Table 1 for a list of species); accession identifiers for each sequence are in Table 1 or in METHODS. The magenta box groups the Drosophila Spp orthologs; light pink, other insect Spp orthologs; white, human SPP, SPPL2a, SPPL2b, SPPL2c, SPPL3; blue, Drosophila SppL orthologs; and light blue, other insect SppL orthologs. SppL proteins are more closely related to human SPPL3 than to SPP or SPPL2a, b, or c; and the SppL sequences retain a higher interspecies conservation than Spp sequences. (The apparently truncated sequence of the D. virilis SppL ortholog is not included in this analysis.).
sppL expression and SppL subcellular localization
To determine if Drosophila sppL is expressed, we probed embryos and larvae for transcripts by in situ hybridization. In embryos, we detected sppL transcripts that were uniformly distributed at cellular blastoderm (Fig. 4A). During gastrulation, expression in the mesoderm was prominent during early germ band extension (Fig. 4B), and was more pronounced at full germ band extension stages in the anterior and medial portions of the midgut (Fig. 4C). Expression continued to be strong in the midgut after germ band retraction, while expression in the mesoderm diminished (Fig. 4D, E). By late embryogenesis, expression of sppL was no longer detected (Fig. 4F). Although we did not detect expression in larval imaginal tissues (data not shown), transcriptional profiling reported by modENCODE identifies expression at all stages [38]. The expression program of sppL contrasts with that of spp [23]. spp expression was not detected in blastoderm stage embryos, but was detected during later embryo stages and in imaginal discs [23]. Expression in the developing trachea of embryos was consistent with the presence of incomplete tracheal air filling in spp mutants [23].
(A) A uniform distribution of sppL transcripts was detected near the surface of embryos by in situ hybridization at the cellular blastoderm stage. (B) At early germ band extension (stage 7), mesodermal expression is apparent. (C) At late germ band extension (stage 9), strong expression of sppL is seen in the developing midgut. (D) At germ band retraction (stage 12) and (E) dorsal closure (stage 14), midgut expression remains strong, while mesodermal expression is beginning to fade. (F) By late embryogenesis (stage 16), expression of sppL is no longer detectable.
We examined the subcellular localization of SppL and compared it with that of Spp. Spp protein was found primarily in a strong perinuclear ring and reticular pattern that is consistent with the morphology of the ER, and it co-localized with the ER marker Calreticulin-GFP-KDEL. In order to detect SppL protein, we engineered a MYC tag at the amino terminus of SppL. When this protein was expressed in Drosophila S2 cells, we detected a punctate staining pattern accompanied by a weak perinuclear ring. This pattern contrasts with the ring of expression and lacy reticular staining of Spp. While there was some co-localization of SppL and Calreticulin-GFP-KDEL, the two patterns were distinct (Fig. 5A–C). SppL did co-localize almost perfectly with KDEL receptor-GFP, suggesting that SppL resides in both the ER and Golgi (Fig. 5D–F). The intracellular distribution of SppL is similar to that of human SPPL3, which localizes predominantly to the Golgi [19]. Possibly relevant are sequences in Spp and SppL that may target them to the secretory pathway. However, whereas Spp has a C-terminal KKXX motif that putatively targets it for ER retention, intracellular localization of Spp was unchanged when a C-terminal Myc sequence tag was fused downstream of this sequence [23].
S2 cells were transfected two express either (A–C) MYC-SppL and Crc-GFP-KDEL marking ER, or (D–F) MYC-SppL and KDEL Receptor-GFP marking Golgi and ER. (C, F) In the merged images, MYC-SppL is in red the GFP fusion proteins are in green. Hoechst staining of nuclei is included in blue (note that only two cells in each frame were transfected). While some colocalization of SppL and the ER marker can be seen in C, extensive colocalization with the ER and Golgi marker is evident in F.
sppL mutations
To assess sppL function by loss-of-function genetics, we made sppL deletion alleles in two ways. First, we removed a portion of the sppL transcription unit by imprecise excision of a P transposon (P{lacW}sppLSH116). sppL is predicted to produce five transcripts that are distinguished by alternate use of three non-coding exons that contribute to the 5′UTRs of all of the sppL mRNA species [39; see Fig. 6]. These five transcripts share a large 5′-proximal intron where P{lacW}sppLSH116 has inserted. P{lacW}sppLSH116 was isolated as a lethal in a screen for P element mutations [28]. We determined that recombination of the P{lacW}sppLSH116 chromosome yielded viable transposon-bearing chromosomes, indicating that the lethality of P{lacW}sppLSH116 does not reside with the insertion. We sequenced PCR products amplified with primers that flanked the published insertion site and confirmed its orientation and location 2168 bases downstream of the most 5′ sppL start site and within the large sppL intron (Fig. 6). P{lacW}sppLSH116 flies were engineered to express P element transposase, and progeny were screened to identify approximately 1000 that lacked the w+ marker of P{lacW}. Lines were created from these w− excisions, and genomic DNA from these lines was then screened in pools of ten using four PCR reactions. The positions of the proximal primer (▸ at 1.6 kb) and four distal primers (◂ at 2.6, 3.6, 4.6, and 5.7 kb) are indicated in Figure 6. Deletions resulting from imprecise excision generated PCR products that were cloned and sequenced. Ten independent deletions within sppL ranging in size from 0.8 to 2.5 kb were identified. Deletions 24J and 57D were the largest. Proximal to the transposon insertion, they eliminate the branch points for the introns between exons N2-N3 and N2-C1; distally, they remove the translation start, the first transmembrane (e.g. TM1) domain, and part of the loop between TM1 and TM2 (Figs. 1, 6).
This cartoon of 9.5 kb of chromosome III at cytological band 96F5-6 depicts the sppL gene and the ends of the adjacent Tsp96 (pink) and Lnk (blue) genes. Colored boxes indicate the sppL exon structure: coding regions (green) and non-coding 5′ and 3′ UTRs (yellow). The predicted “start” and “stop” codons of sppL are indicated. Exons N1-N3 are entirely non-coding, while exons C1–C6 contain the sppL open reading frame. The insertion sites of transposons P{lacW}sppLSH116 (also known as P{lacW}l(3)SH116sh116), PBac{XP}Lnkd07478, and PBac{RB}CG17370e00372 are indicated with red triangles. Imprecise excision of P{lacW}sppLSH116 generated the deletion alleles sppL24J and sppL57D. Recombination between the two PBac insertions was used to generate deletion Df(3R)sppL. The extent of these deletions is indicated within parentheses. The sppL57D deletion (not shown) is similar to sppL24J. Black triangles indicate the positions of proximal (▸) and distal (◂) primers used to screen for excision mutants, denoting the positions of the following oligo sites: osppL-2000s, osppL-4000a, osppL-5000a, osppL-6000a, and osppL-7250a.
Second, a deletion (Df(3R)sppL) was created by selecting w− recombinants between chromosomes carrying FRT elements PBac{RB}CG17370e00372 and PBac{XP}Lnkd07478 [30] that flank the sppL protein-coding region [31]. Df(3R)sppL deleted all sppL sequence from a point 5′ of the coding region within the large intron and extends into the neighboring Lnk gene (Fig. 6). Lnk, which has been implicated in insulin receptor signaling, is not an essential gene [40], [41], [42]. We confirmed the identity of this deletion by PCR analysis, verifying recombination between the FRT elements (according to) [31] and the inability to amplify sppL sequences from deletion homozygotes (not shown).
The Df(3R)sppL, sppL24J and sppL57D alleles are viable, and Df(3R)sppL could be maintained as a stock without a balancer chromosome (see Table 2). No morphological abnormalities were apparent in these flies. Whereas sppL24J and sppL57D were sickly as homozygotes and were poorly viable, both were viable in trans with Df(3R)sppL and eclosed with Mendelian frequencies. In addition, sppL hemizygotes had similar life spans compared to heterozygous siblings. Female sppL24J/Df(3R)sppL and sppL57D/Df(3R)sppL lived an average of 13.9±2.6 and 11.2±2.4 weeks, respectively, while males of the same genotype lived 13.2±2.7 and 9.9±3.0 weeks. Heterozygous male and female Df(3R)sppL/TM3 Sb1 lived 12.6±1.4 and 8.8±2.0 weeks. All these measured lifespans are similar to wild type strains [43], [44], indicating that sppL is not an essential gene under the conditions we tested.
To investigate whether sppL function is redundant to other I-CLiPs, these sppL alleles were crossed with spp and S2P mutants. Whereas loss of spp was lethal during early larval development, removal of sppL in the haplo-spp backgrounds spp5/+ or Df(lwr)14, P(lwr+)/+ heterozygotes had no noticeable effect on viability, morphology, or fertility. Lethality of spp sppL double mutants occurred during early larval stages, as it did in spp mutants, and removal of sppL function did not enhance the spp tracheal air-filling defect. There is no confounding maternal effect of sppL expression, since sppL− females were used to generate the double mutant larvae. Over-expression studies were similarly unrevealing. Whereas ectopic expression of spp distorts adult wing morphology, no morphological phenotypes were observed in the adult flies after ectopic expression of sppL using a variety of strong GAL4 drivers (e.g., GMR, ptc, en, T80) at 29°C. Our experiments therefore did not identify a genetic interaction between spp and sppL. We also asked if sppL interacts genetically with S2P, since both of these I-CLiPs are non-essential but might share essential functions. Using the null mutant S2P1, which can be maintained as a homozygous stock [6], we created double mutants of S2P1 and either sppL57D/Df(3R)sppL or sppL24J/Df(3R)sppL. These double mutants were viable, were normal in size and shape, and fertile.
The accumulation of misfolded proteins in the ER triggers the unfolded protein response (UPR) [45]. Because the vertebrate SPP protein was been reported to be associated with the enzymes responsible for carrying out ER-associated degradation [46], and because loss of secretory pathway intramembrane proteases might increase uncleaved proteins or peptides in the ER, we examined the UPR in spp and sppL mutants. Unexpectedly, our assays of the UPR-induced alternative splicing of XbpI in control and mutant larvae revealed a decrease of the UPR in the absence of spp (Fig. 7). Lack of sppL function had no apparent effect on these assays of the UPR.
A 77 base pair alternative splice product of the Xbp I cDNA is made after induction of the UPR by DTT. Genotypes are w (w1118), spp (w118, Df(2L)lwr14 p(lwr+)), sppL (w118, Df(3R)sppL), and spp sppL (w118, Df(2L)lwr14, p(lwr+), sppLBW1). Samples of RNA were prepared from freshly dissected larvae (0 hour) or from larvae incubated in media for 2 hours with or without DTT. Relative intensities of the upper (100 bp) and lower (77 bp) bands in the experimental samples were calculated from the total intensity in each band measured with ImageJ.
Discussion
The presence of sppL in the D. melanogaster genome is not unique among insects; indeed, BLAST searches of the genome sequences of sixteen other insect species revealed that all include genes that can encode one Spp and one SppL protein (Table 1). BLAST searches identified the five vertebrate Spp family members, but only two were detected in insect genomes. The genomes we queried were from ten other Drosophila species (D. ananassae, D. erecta, D. grimshawi, D. mojavensis, D. persimilis, D. pseudoobscura, D. sechellia, D. simulans, D. willistoni, and D. yakuba), three mosquito species (A. aegypti and A. gambiae), honeybee (A. mellifera), wasp (N. vitripennis) and beetle (T. castaneum). In each genome, the SPPL protein retains higher sequence homology to human SPPL3 and D. melanogaster SppL than it does to SPP or to the vertebrate SPPL2a/b/c proteins (Fig. 3).
Spp and SppL share overall topology and conserved motifs, including putative aspartyl protease active sites (Figs. 1, 2). Both Spp and SppL proteins purified from bacterial extracts can cleave a model prolactin signal sequence, suggesting that their activities do not depend on protein glycosylation or on other associated proteins [47]. Despite these similarities, Spp and SppL are distinct. Their expression patterns are largely non-overlapping during development, and their subcellular locations differ (Figs. 4, 5). However, because SPP family proteases are thought to have substrate specificity in vivo [13], we cannot yet comment on putative activities of SppL. Over-expression of Spp caused developmental defects such as wing truncations; in contrast, ectopic expression of SppL produced no apparent defects.
Most strikingly, spp provides an essential function during development, while sppL is not required for viability or patterning. Because knockdown of Xenopus, C. elegans and D. rerio SPPL genes caused significant developmental abnormalities, we expected to identify an essential role for Drosophila sppL, but sppL mutants developed without apparent defects, and spp sppL double mutants were indistinguishable from spp single mutants (Table 2). This contrasts with Drosophila spp [23] and with presenilin, for which functional disruption in a variety of organisms causes developmental defects due to the failure to activate the Notch signaling pathway (for review, see) [48]. Spp targets type 2 transmembrane segments, and since the putative catalytic sites of SppL and Spp have the same orientation in their respective transmembrane segments 6 and 7, functional redundancy of SppL with either Spp might be expected. Yet despite the absence of an apparent sppL mutant phenotype, the strong evolutionary conservation of this gene suggests that SppL might be redundant with another I-CLiP(s) or protease(s), precedents being S2P and the caspase Drice in the Drosophila SREBP pathway [49].
A recent report on the toxicity of over-expressed human Huntingtin protein in Drosophila indicates that loss-of-function alleles of spp and sppL reduced Huntingtin-induced motor deficits in mutant flies [50]. Thus, whereas sppL loss-of-function alleles do not manifest apparent insufficiency under the standard laboratory conditions, the “sensitized” genetic background in which Huntingtin is over-expressed unmasked a critical role for sppL function. Further studies of Huntingtin may be aided by the sppL mutants and expression patterns we have described, and such studies may lead to a better understanding of the putative genetic redundancy of sppL.
Human SPP may be a component of the ER-associated protein degradation (ERAD) response [46]. Although our assays did not identify a role for sppL in the ER stress response, we observed that loss of spp decreased the UPR, a result that suggests that Spp activity might facilitate the UPR. Our data does not discriminate between any of the possible mechanisms for this role.
Our findings are reminiscent of genetic studies on the SPP-related genes of C. elegans. The C. elegans genome encodes a single SPP (Imp-2) protein, a closely related SPPL (Imp-1), and a distantly related SPP-like sequence (Imp-1) [14]; the C. briggsae genome encodes a comparable cadre of SPP relatives. As with Drosophila spp and sppL mutants, RNAi directed against imp-2 caused developmental defects, while RNAi directed against imp-1 and imp-3 caused no obvious developmental abnormalities [20]. These data for Drosophila and C. elegans contrast with genetic studies in zebrafish, in which developmental defects were observed after spp, sppL2a or sppL3 were targeted by morpholinos [21]. We suggest that in contrast to the invertebrate proteins, the vertebrate SPP family proteins acquired new essential functions by processes of gene duplication and diversification.
Acknowledgments
For providing Drosophila lines, we thank Rob Rawson (U. Texas, Southwest Medical Center), the Bloomington and Szeged Drosophila Stock Centers, and the Exelixis Collection at Harvard Medical School. We also thank Hyung Don Ryoo, Susan Younger, Bruno Martoglio, Prashanth Rao, Sougata Roy, Kevin Hill, and Brenda Ng for helpful discussions, Prashanth Rao for critically reading the manuscript, and Katja Bruckner, Eric Rulifson, Bree Grillo-Hill and Helen Wong for sharing equipment and reagents.
Author Contributions
Conceived and designed the experiments: DJC BB TBK. Performed the experiments: DJC SL BB. Analyzed the data: DJC SL BB TBK. Contributed reagents/materials/analysis tools: DJC SL BB. Wrote the paper: DJC TBK.
References
- 1. Wolfe MS (2009) Intramembrane-cleaving Proteases. J Biol Chem 284: 13969–13973.
- 2. De Strooper B, Annaert W, Cupers P, Saftig P, Craessaerts K, et al. (1999) A presenilin-1-dependent gamma-secretase-like protease mediates release of Notch intracellular domain. Nature 398: 518–522.
- 3. Struhl G, Greenwald I (1999) Presenilin is required for activity and nuclear access of Notch in Drosophila. Nature 398: 522–525.
- 4. Ye Y, Lukinova N, Fortini ME (1999) Neurogenic phenotypes and altered Notch processing in Drosophila Presenilin mutants. Nature 398: 525–529.
- 5. Urban S, Lee JR, Freeman M (2002) A family of Rhomboid intramembrane proteases activates all Drosophila membrane-tethered EGF ligands. EMBO J 21: 4277–4286.
- 6. Matthews KA, Kunte AS, Tambe-Ebot E, Rawson RB (2009) Alternative processing of sterol regulatory element binding protein during larval development in Drosophila melanogaster. Genetics 181: 119–128.
- 7. Weihofen A, Lemberg MK, Ploegh HL, Bogyo M, Martoglio B (2000) Release of signal peptide fragments into the cytosol requires cleavage in the transmembrane region by a protease activity that is specifically blocked by a novel cysteine protease inhibitor. J Biol Chem 275: 30951–30956.
- 8. Weihofen A, Binns K, Lemberg MK, Ashman K, Martoglio B (2002) Identification of signal peptide peptidase, a presenilin-type aspartic protease. Science 296: 2215–2218.
- 9. Lemberg MK, Bland FA, Weihofen A, Braud VM, Martoglio B (2001) Intramembrane proteolysis of signal peptides: an essential step in the generation of HLA-E epitopes. J Immunol 167: 6441–6446.
- 10. McLauchlan J, Lemberg MK, Hope G, Martoglio B (2002) Intramembrane proteolysis promotes trafficking of hepatitis C virus core protein to lipid droplets. EMBO J 21: 3980–3988.
- 11. Martoglio B, Graf R, Dobberstein B (1997) Signal peptide fragments of preprolactin and HIV-1 p-gp160 interact with calmodulin. EMBO J 16: 6636–6645.
- 12. Loureiro J, Lilley BN, Spooner E, Noriega V, Tortorella D, et al. (2006) Signal peptide peptidase is required for dislocation from the endoplasmic reticulum. Nature 441: 894–897.
- 13. Kilic A, Klose S, Dobberstein B, Knust E, Kapp K (2010) The Drosophila Crumbs signal peptide is unusually long and is a substrate for signal peptide peptidase. Eur J Cell Biol 89: 449–461.
- 14. Ponting CP, Hutton M, Nyborg A, Baker M, Jansen K, et al. (2002) Identification of a novel family of presenilin homologues. Hum Mol Genet 11: 1037–1044.
- 15. Friedmann E, Lemberg MK, Weihofen A, Dev KK, Dengler U, et al. (2004) Consensus analysis of signal peptide peptidase and homologous human aspartic proteases reveals opposite topology of catalytic domains compared with presenilins. J Biol Chem 279: 50790–50798.
- 16. Fluhrer R, Grammer G, Israel L, Condron MM, Haffner C, et al. (2006) A gamma-secretase-like intramembrane cleavage of TNFalpha by the GxGD aspartyl protease SPPL2b. Nat Cell Biol 8: 894–896.
- 17. Kirkin V, Cahuzac N, Guardiola-Serrano F, Huault S, Luckerath K, et al. (2007) The Fas ligand intracellular domain is released by ADAM10 and SPPL2a cleavage in T-cells. Cell Death Differ 14: 1678–1687.
- 18. Martin L, Fluhrer R, Reiss K, Kremmer E, Saftig P, et al. (2008) Regulated intramembrane proteolysis of Bri2 (Itm2b) by ADAM10 and SPPL2a/SPPL2b. J Biol Chem 283: 1644–1652.
- 19. Friedmann E, Hauben E, Maylandt K, Schleeger S, Vreugde S, et al. (2006) SPPL2a and SPPL2b promote intramembrane proteolysis of TNFalpha in activated dendritic cells to trigger IL-12 production. Nat Cell Biol 8: 843–848.
- 20. Grigorenko AP, Moliaka YK, Soto MC, Mello CC, Rogaev EI (2004) The Caenorhabditis elegans IMPAS gene, imp-2, is essential for development and is functionally distinct from related presenilins. Proc Natl Acad Sci U S A 101: 14955–14960.
- 21. Krawitz P, Haffner C, Fluhrer R, Steiner H, Schmid B, et al. (2005) Differential localization and identification of a critical aspartate suggest non-redundant proteolytic functions of the presenilin homologues SPPL2b and SPPL3. J Biol Chem 280: 39515–39523.
- 22. Han S, Green L, Schnell DJ (2009) The signal peptide peptidase is required for pollen function in Arabidopsis. Plant Physiol 149: 1289–1301.
- 23. Casso DJ, Tanda S, Biehs B, Martoglio B, Kornberg TB (2005) Drosophila signal peptide peptidase is an essential protease for larval development. Genetics 170: 139–148.
- 24. Poole SJ, Kauvar LM, Drees B, Kornberg T (1985) The engrailed locus of Drosophila: structural analysis of an embryonic transcript. Cell 40: 37–43.
- 25. Brand AH, Perrimon N (1993) Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118: 401–415.
- 26. Ishikawa T, Matsumoto A, Kato T Jr, Togashi S, Ryo H, et al. (1999) DCRY is a Drosophila photoreceptor protein implicated in light entrainment of circadian rhythm. Genes Cells 4: 57–65.
- 27. Biehs B, Sturtevant MA, Bier E (1998) Boundaries in the Drosophila wing imaginal disc organize vein-specific genetic programs. Development 125: 4245–4257.
- 28. Oh SW, Kingsley T, Shin HH, Zheng Z, Chen HW, et al. (2003) A P-element insertion screen identified mutations in 455 novel essential genes in Drosophila. Genetics 163: 195–201.
- 29.
Ashburner M (1989) Drosophila: A laboratory manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press. pp. 44–49.
- 30. Thibault ST, Singer MA, Miyazaki WY, Milash B, Dompe NA, et al. (2004) A complementary transposon tool kit for Drosophila melanogaster using P and piggyBac. Nat Genet 36: 283–287.
- 31. Parks AL, Cook KR, Belvin M, Dompe NA, Fawcett R, et al. (2004) Systematic generation of high-resolution deletion coverage of the Drosophila melanogaster genome. Nat Genet 36: 288–292.
- 32. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403–410.
- 33. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22: 4673–4680.
- 34. Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, et al. (2003) Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res 31: 3497–3500.
- 35. Pethica R, Barker G, Kovacs T, Gough J (2010) TreeVector: scalable, interactive, phylogenetic trees for the web. PLoS One 5: e8934.
- 36. Krogh A, Larsson B, von Heijne G, Sonnhammer EL (2001) Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol 305: 567–580.
- 37. Tusnady GE, Simon I (2001) The HMMTOP transmembrane topology prediction server. Bioinformatics 17: 849–850.
- 38. Roy S, Ernst J, Kharchenko PV, Kheradpour P, Negre N, et al. (2010) Identification of functional elements and regulatory circuits by Drosophila modENCODE. Science 330: 1787–1797.
- 39. Stapleton M, Liao G, Brokstein P, Hong L, Carninci P, et al. (2002) The Drosophila gene collection: identification of putative full-length cDNAs for 70% of D. melanogaster genes. Genome Res 12: 1294–1300.
- 40. Slack C, Werz C, Wieser D, Alic N, Foley A, et al. (2010) Regulation of lifespan, metabolism, and stress responses by the Drosophila SH2B protein, Lnk. PLoS Genet 6: e1000881.
- 41. Song W, Ren D, Li W, Jiang L, Cho KW, et al. (2010) SH2B regulation of growth, metabolism, and longevity in both insects and mammals. Cell Metab 11: 427–437.
- 42. Werz C, Kohler K, Hafen E, Stocker H (2009) The Drosophila SH2B family adaptor Lnk acts in parallel to chico in the insulin signaling pathway. PLoS Genet 5: e1000596.
- 43. Paaby AB, Schmidt PS (2009) Dissecting the genetics of longevity in Drosophila melanogaster. Fly (Austin) 3: 29–38.
- 44. Spencer CC, Howell CE, Wright AR, Promislow DE (2003) Testing an ‘aging gene’ in long-lived drosophila strains: increased longevity depends on sex and genetic background. Aging Cell 2: 123–130.
- 45. Ron D, Walter P (2007) Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 8: 519–529.
- 46. Christianson JC, Olzmann JA, Shaler TA, Sowa ME, Bennett EJ, et al. (2012) Defining human ERAD networks through an integrative mapping strategy. Nat Cell Biol 14: 93–105.
- 47. Narayanan S, Sato T, Wolfe MS (2007) A C-terminal region of signal peptide peptidase defines a functional domain for intramembrane aspartic protease catalysis. J Biol Chem 282: 20172–20179.
- 48. Chan YM, Jan YN (1999) Presenilins, processing of beta-amyloid precursor protein, and notch signaling. Neuron 23: 201–204.
- 49. Amarneh B, Matthews KA, Rawson RB (2009) Activation of SREBP by the caspase drice in Drosophila larvae. J Biol Chem.
- 50. Miller JP, Holcomb J, Al-Ramahi I, de Haro M, Gafni J, et al. (2010) Matrix metalloproteinases are modifiers of huntingtin proteolysis and toxicity in Huntington's disease. Neuron 67: 199–212.